ID: 1109761110_1109761118

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1109761110 1109761118
Species Human (GRCh38) Human (GRCh38)
Location 13:66830260-66830282 13:66830306-66830328
Sequence CCCATATGACTGTTCAACCTGGA CTGCTTCATTTGGGGCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97} {0: 1, 1: 0, 2: 0, 3: 12, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!