ID: 1109766469_1109766475

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1109766469 1109766475
Species Human (GRCh38) Human (GRCh38)
Location 13:66906583-66906605 13:66906607-66906629
Sequence CCCCAAGCCTCTCCTGTGTTTCA TCTGGAGCAGCTCCTGTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 341} {0: 1, 1: 0, 2: 1, 3: 23, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!