ID: 1109777653_1109777661

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1109777653 1109777661
Species Human (GRCh38) Human (GRCh38)
Location 13:67063255-67063277 13:67063293-67063315
Sequence CCAGCCCAGCAGGGATAAACCTC TCATTGTGTACCATTCACAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 90, 4: 2396} {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!