ID: 1109977683_1109977690

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1109977683 1109977690
Species Human (GRCh38) Human (GRCh38)
Location 13:69861620-69861642 13:69861660-69861682
Sequence CCCACCTAACCTCTTATCCTGTC TAAAAGCAAGCCTGGCGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 165} {0: 1, 1: 0, 2: 11, 3: 239, 4: 2067}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!