ID: 1109980273_1109980276

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1109980273 1109980276
Species Human (GRCh38) Human (GRCh38)
Location 13:69897894-69897916 13:69897911-69897933
Sequence CCTGTGGTTACTGAGTCCAGTTA CAGTTAAACCTCAGGAACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95} {0: 1, 1: 0, 2: 2, 3: 12, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!