ID: 1109993846_1109993859

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1109993846 1109993859
Species Human (GRCh38) Human (GRCh38)
Location 13:70095816-70095838 13:70095848-70095870
Sequence CCCTTCTCCCTCCACCCCCCCCA CTAATACTCTTTCCAGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 29, 3: 863, 4: 11142} {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!