ID: 1110100829_1110100833

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1110100829 1110100833
Species Human (GRCh38) Human (GRCh38)
Location 13:71598916-71598938 13:71598962-71598984
Sequence CCCTAGTTATTTTTATATTTTGT CTAACTTTTTTAAAGTGTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 25, 3: 177, 4: 2422} {0: 1, 1: 0, 2: 0, 3: 36, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!