ID: 1110109877_1110109881

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1110109877 1110109881
Species Human (GRCh38) Human (GRCh38)
Location 13:71732671-71732693 13:71732712-71732734
Sequence CCTACCTTTATTTGTAAATACAG ACAACCTTTTGTTTATTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 425} {0: 1, 1: 0, 2: 3, 3: 46, 4: 537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!