ID: 1110192377_1110192382

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1110192377 1110192382
Species Human (GRCh38) Human (GRCh38)
Location 13:72745303-72745325 13:72745333-72745355
Sequence CCATGGTTGCTTTCTGTCTCTAG GTGGAAAAGAGGGATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 367} {0: 24, 1: 33, 2: 46, 3: 144, 4: 1147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!