|
Left Crispr |
Right Crispr |
Crispr ID |
1110212299 |
1110212307 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:72987950-72987972
|
13:72987976-72987998
|
Sequence |
CCCCCCGGGTTTATGTGATTCTC |
CCTCAGCCTCCCAAGTAACTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 447, 2: 18042, 3: 94413, 4: 187475} |
{0: 2835, 1: 101216, 2: 211662, 3: 252465, 4: 268723} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|