ID: 1110212300_1110212305

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1110212300 1110212305
Species Human (GRCh38) Human (GRCh38)
Location 13:72987951-72987973 13:72987975-72987997
Sequence CCCCCGGGTTTATGTGATTCTCC GCCTCAGCCTCCCAAGTAACTGG
Strand - +
Off-target summary {0: 1, 1: 26, 2: 567, 3: 3232, 4: 7111} {0: 2348, 1: 88449, 2: 198708, 3: 240149, 4: 234925}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!