ID: 1110583094_1110583101

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1110583094 1110583101
Species Human (GRCh38) Human (GRCh38)
Location 13:77155828-77155850 13:77155875-77155897
Sequence CCCCGTAACAGGTAGCAAAATGT AGGTGTAACTTGGACACTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 76} {0: 1, 1: 0, 2: 1, 3: 9, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!