ID: 1110705375_1110705381

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1110705375 1110705381
Species Human (GRCh38) Human (GRCh38)
Location 13:78597728-78597750 13:78597748-78597770
Sequence CCCGCCGCCGCCTGGATTTCCTG CTGAGAAGCTGAAATGCAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165} {0: 1, 1: 0, 2: 4, 3: 48, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!