ID: 1110880236_1110880239

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1110880236 1110880239
Species Human (GRCh38) Human (GRCh38)
Location 13:80562804-80562826 13:80562838-80562860
Sequence CCATTGCTTTACAGAGGAAGTAT CTGTAAGCATAGATCAGGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!