ID: 1111169678_1111169680

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1111169678 1111169680
Species Human (GRCh38) Human (GRCh38)
Location 13:84509282-84509304 13:84509302-84509324
Sequence CCTTTTTGTGGCAATTGTGGCTA CTAGGATTGCCTTTCCGATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 124, 4: 895}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!