ID: 1111302782_1111302790

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1111302782 1111302790
Species Human (GRCh38) Human (GRCh38)
Location 13:86366773-86366795 13:86366824-86366846
Sequence CCACATTCCTCTGCCTGCTTTTA GTATCCATCCAGATTGAGGGTGG
Strand - +
Off-target summary {0: 33, 1: 135, 2: 250, 3: 415, 4: 1022} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!