ID: 1111750680_1111750687

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1111750680 1111750687
Species Human (GRCh38) Human (GRCh38)
Location 13:92327979-92328001 13:92328025-92328047
Sequence CCAGCCAGGCCTGATCCTCTTTG CTGTGCTTCTTCAGGGCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 264} {0: 1, 1: 0, 2: 0, 3: 17, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!