ID: 1111828301_1111828309

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1111828301 1111828309
Species Human (GRCh38) Human (GRCh38)
Location 13:93296258-93296280 13:93296300-93296322
Sequence CCTCTGGAATTCCTCTGAAACCC CACTGTCACTGTCTTTGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 167} {0: 1, 1: 0, 2: 5, 3: 62, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!