|
Left Crispr |
Right Crispr |
| Crispr ID |
1111844926 |
1111844934 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:93496112-93496134
|
13:93496162-93496184
|
| Sequence |
CCTCCCCCAGCCTTGCTGCCTCC |
TAGCAATCAGCGAGAGTCCGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 379, 2: 2049, 3: 2270, 4: 2470} |
{0: 2, 1: 1411, 2: 1161, 3: 881, 4: 953} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|