ID: 1111844932_1111844936

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1111844932 1111844936
Species Human (GRCh38) Human (GRCh38)
Location 13:93496130-93496152 13:93496169-93496191
Sequence CCTCCTTGCAGTTTGATCTCAGA CAGCGAGAGTCCGTGGGCGTAGG
Strand - +
Off-target summary {0: 2869, 1: 1007, 2: 456, 3: 293, 4: 360} {0: 2, 1: 1065, 2: 989, 3: 833, 4: 1027}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!