ID: 1111855723_1111855730

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1111855723 1111855730
Species Human (GRCh38) Human (GRCh38)
Location 13:93634656-93634678 13:93634700-93634722
Sequence CCATCACATTTGAGTTTCTAGAA CAGTAGGAAAGGAAGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 267} {0: 1, 1: 1, 2: 15, 3: 271, 4: 2663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!