ID: 1111915629_1111915632

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1111915629 1111915632
Species Human (GRCh38) Human (GRCh38)
Location 13:94357241-94357263 13:94357255-94357277
Sequence CCAAACTAACTACTTTCCAAACC TTCCAAACCCTTAGTGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147} {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!