ID: 1111989692_1111989699

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1111989692 1111989699
Species Human (GRCh38) Human (GRCh38)
Location 13:95104237-95104259 13:95104282-95104304
Sequence CCAAGTAGCTGGGATTACAGGTG TTTTGGGTTTTTAGTAAAGATGG
Strand - +
Off-target summary {0: 27298, 1: 77225, 2: 165100, 3: 221696, 4: 302720} {0: 1, 1: 258, 2: 13954, 3: 218117, 4: 144584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!