ID: 1112029521_1112029527

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1112029521 1112029527
Species Human (GRCh38) Human (GRCh38)
Location 13:95444283-95444305 13:95444315-95444337
Sequence CCACTGCTCCTAAATGAACTTGG CTTGAATTGCAGAAGGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 132} {0: 1, 1: 0, 2: 0, 3: 21, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!