ID: 1112032564_1112032570

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1112032564 1112032570
Species Human (GRCh38) Human (GRCh38)
Location 13:95471076-95471098 13:95471121-95471143
Sequence CCTAGCCTCACAGAGGATTAGAA CACTGTGACCTGAAGGAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 217} {0: 1, 1: 0, 2: 3, 3: 44, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!