ID: 1112041679_1112041689

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1112041679 1112041689
Species Human (GRCh38) Human (GRCh38)
Location 13:95553316-95553338 13:95553363-95553385
Sequence CCGCTGGGACCCAGAGTTCATGC CCCTCCCCTACGTTCCCCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 194} {0: 1, 1: 0, 2: 1, 3: 4, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!