ID: 1112123700_1112123706

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1112123700 1112123706
Species Human (GRCh38) Human (GRCh38)
Location 13:96441073-96441095 13:96441107-96441129
Sequence CCCTCCACCATATGCAGATTCAA CTGTCTGTAAACCAGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 299} {0: 1, 1: 28, 2: 89, 3: 321, 4: 925}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!