ID: 1112127292_1112127295

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1112127292 1112127295
Species Human (GRCh38) Human (GRCh38)
Location 13:96481997-96482019 13:96482018-96482040
Sequence CCTTCTGTGCTTCATTAACTCCA CAAAAATAAAAGAATAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 279} {0: 2, 1: 2, 2: 185, 3: 4445, 4: 36592}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!