ID: 1112142960_1112142976

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1112142960 1112142976
Species Human (GRCh38) Human (GRCh38)
Location 13:96666251-96666273 13:96666302-96666324
Sequence CCCACCATGATTCAATTACCTTC ATTATAGGGACTACAATTCAAGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 153, 3: 345, 4: 580} {0: 2, 1: 18, 2: 225, 3: 432, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!