ID: 1112142961_1112142974

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1112142961 1112142974
Species Human (GRCh38) Human (GRCh38)
Location 13:96666252-96666274 13:96666287-96666309
Sequence CCACCATGATTCAATTACCTTCC TGATGACATGGGGGGATTATAGG
Strand - +
Off-target summary {0: 184, 1: 3372, 2: 6558, 3: 9434, 4: 9921} {0: 1, 1: 2, 2: 45, 3: 516, 4: 1606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!