ID: 1112324916_1112324919

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1112324916 1112324919
Species Human (GRCh38) Human (GRCh38)
Location 13:98437716-98437738 13:98437748-98437770
Sequence CCTGTATAGCTTCTCCGCTTTGT TTCTCTCGGTCCCACCAGCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 69} {0: 1, 1: 1, 2: 3, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!