ID: 1112332696_1112332703

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1112332696 1112332703
Species Human (GRCh38) Human (GRCh38)
Location 13:98488897-98488919 13:98488937-98488959
Sequence CCTGAAATGCCCTTGGCAGCCTC AACCAAAGGCCAAGACCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 213} {0: 1, 1: 1, 2: 1, 3: 27, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!