ID: 1112344719_1112344722

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1112344719 1112344722
Species Human (GRCh38) Human (GRCh38)
Location 13:98579508-98579530 13:98579554-98579576
Sequence CCACACTGACCATTGTTTCATCC GCACCATTCTTATCGAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 251} {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!