ID: 1112371179_1112371184

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1112371179 1112371184
Species Human (GRCh38) Human (GRCh38)
Location 13:98795125-98795147 13:98795159-98795181
Sequence CCTTCTACGCTCACCAGATCATA GGTCTACTTAAGGCAACGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50} {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!