ID: 1112423193_1112423197

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1112423193 1112423197
Species Human (GRCh38) Human (GRCh38)
Location 13:99272444-99272466 13:99272491-99272513
Sequence CCCAGGAGCAGGAATGTAGGGTC AACTCGTGCTGTCATAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 281} {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!