ID: 1112428976_1112428985

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1112428976 1112428985
Species Human (GRCh38) Human (GRCh38)
Location 13:99332850-99332872 13:99332891-99332913
Sequence CCCCCTGACACACAAATCCAACA CCTGCTTTTCAGAGGGTCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 299} {0: 1, 1: 0, 2: 2, 3: 21, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!