ID: 1112490493_1112490497

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1112490493 1112490497
Species Human (GRCh38) Human (GRCh38)
Location 13:99858988-99859010 13:99859001-99859023
Sequence CCCGGGTCCTTCCTTCCAGCCTG TTCCAGCCTGATGCTACCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 492} {0: 1, 1: 0, 2: 1, 3: 14, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!