ID: 1112527482_1112527485

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1112527482 1112527485
Species Human (GRCh38) Human (GRCh38)
Location 13:100165711-100165733 13:100165739-100165761
Sequence CCTGTACACTTCAGCATGCAGTT AGCAGAGTTCAGGCCAGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 134} {0: 1, 1: 1, 2: 19, 3: 133, 4: 1118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!