ID: 1112557932_1112557938

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1112557932 1112557938
Species Human (GRCh38) Human (GRCh38)
Location 13:100486113-100486135 13:100486141-100486163
Sequence CCTGAAAACTGCCTCATTCTCTG CCTGAAGGAAGGACTCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 297} {0: 1, 1: 0, 2: 2, 3: 24, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!