ID: 1112558913_1112558918

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1112558913 1112558918
Species Human (GRCh38) Human (GRCh38)
Location 13:100494336-100494358 13:100494381-100494403
Sequence CCTTCGGATGCCATGGCTAGGTC TGACTTTAGATTTGAAATTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62} {0: 1, 1: 0, 2: 1, 3: 39, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!