ID: 1112562531_1112562534

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1112562531 1112562534
Species Human (GRCh38) Human (GRCh38)
Location 13:100526848-100526870 13:100526876-100526898
Sequence CCTCAGGATGAAAGGCAAGTTCT CAGTCTGAGCAAAGGCCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 299} {0: 1, 1: 0, 2: 1, 3: 32, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!