ID: 1112576751_1112576758

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1112576751 1112576758
Species Human (GRCh38) Human (GRCh38)
Location 13:100642959-100642981 13:100642993-100643015
Sequence CCAACAAGAAGCCAAAACATCCC ACACTGTAAGAAGCTCAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165} {0: 1, 1: 0, 2: 2, 3: 90, 4: 1402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!