ID: 1112594934_1112594938

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1112594934 1112594938
Species Human (GRCh38) Human (GRCh38)
Location 13:100799179-100799201 13:100799208-100799230
Sequence CCTTACTGTGCATGTGTCAGGGC TTTTCCATTGTGGGCATGTCTGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 24, 3: 49, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!