ID: 1112651029_1112651034

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1112651029 1112651034
Species Human (GRCh38) Human (GRCh38)
Location 13:101398761-101398783 13:101398778-101398800
Sequence CCATGTGACTCTGAGGACAGGGT CAGGGTGCACAGCGTGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 240} {0: 1, 1: 0, 2: 6, 3: 39, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!