ID: 1112715708_1112715712

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1112715708 1112715712
Species Human (GRCh38) Human (GRCh38)
Location 13:102182350-102182372 13:102182370-102182392
Sequence CCCTGCCGACGCCTTGATTTTAG TAGCCCAGTGAGAACTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 329, 3: 1499, 4: 3263} {0: 2, 1: 14, 2: 38, 3: 117, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!