ID: 1112718655_1112718663

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1112718655 1112718663
Species Human (GRCh38) Human (GRCh38)
Location 13:102216336-102216358 13:102216377-102216399
Sequence CCAAACTCCATTTCCTCAAAGTG CAGCAGGATTGAGGTAACATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 292} {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!