ID: 1112776966_1112776970

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1112776966 1112776970
Species Human (GRCh38) Human (GRCh38)
Location 13:102854883-102854905 13:102854912-102854934
Sequence CCTCTGTCTCTCTCTTAATGGTT TTCTGTGTTTGAAGTGAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 403} {0: 1, 1: 1, 2: 4, 3: 39, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!