ID: 1113022741_1113022752

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1113022741 1113022752
Species Human (GRCh38) Human (GRCh38)
Location 13:105906346-105906368 13:105906398-105906420
Sequence CCCATCTGCCCTCGTGAACACCT GAACTCCTGGTCAGAGACTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!