ID: 1113104743_1113104750

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1113104743 1113104750
Species Human (GRCh38) Human (GRCh38)
Location 13:106759917-106759939 13:106759953-106759975
Sequence CCAAAGTAAATTTTTTTCTAAGG ATCTTGGGGTCCATCTGACCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!