ID: 1113148177_1113148188

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1113148177 1113148188
Species Human (GRCh38) Human (GRCh38)
Location 13:107232210-107232232 13:107232259-107232281
Sequence CCTGTTATTCCTACCCTGGATGC AATGGGAAGTTCAAAATCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 99} {0: 1, 1: 0, 2: 3, 3: 40, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!